1296hentry p1 post publish author-textco-biosoftware-inc category-gene-construction-kit-tutorial tag-automark-gck-features tag-enhancers tag-features tag-gene-construction-kit-tutorials tag-genes tag-oligos tag-primers tag-promoter comments-open pings-closed y2012 m09 d30 h08 slug-tutorial-mark-autofeatures

Tutorial: Mark AutoFeatures

1.  Start GCK. 2. Open the file titled Common Features.gcf in the Tutorial Files folder by choosing File > Open… to bring up Figure 2.92. This is a new AutoFeature window. For now, just explore the various options in this window but leave the entries and formatting intact. Entries defined in the left-hand panel can […]
Posted in gene construction kit tutorials | Tagged , , , , , , , | 1 Comment
1301hentry p2 post publish author-textco-biosoftware-inc category-gene-construction-kit-tutorial tag-apply-graphic-formatting tag-copy-style tag-gene-construction-kit-tutorials tag-paste-style comments-open pings-closed y2012 m09 d30 h04 alt slug-tutorial-copy-paste-styles

Tutorial: Copy & Paste Styles

1. Start GCK. 2. Open the file called construct#7 in the Tutorial Files folder by choosing File > Open… . 3. It should be displayed in graphic view, but if not select Construct > Display > Display Graphics . 4. Select the segment of DNA (red circle) that represents the ampicillin resistance gene by double-clicking […]
Posted in gene construction kit tutorials | Tagged , , , | Leave a comment
1265hentry p3 post publish author-textco-biosoftware-inc category-gene-construction-kit-tutorial tag-dna-search tag-find-mismatches-in-sequence tag-find-sequence tag-gene-construction-kit-tutorials comments-open pings-closed y2012 m09 d30 h04 slug-tutorial-find-sequence

Tutorial: Find Sequence

1. Start GCK. 2. Open the file called pBR322 in the Tutorial Files folder by choosing File > Open… . 3. Choose Edit > Find > Find.. . to bring up Figure 2.91. 4. Enter the first few characters (or Copy and Paste) from the following nucleotide string into the Find window: ACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGA GCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCG Note: […]
Posted in gene construction kit tutorials | Tagged , , , | Leave a comment
1306hentry p4 post publish author-textco-biosoftware-inc category-gene-construction-kit-tutorial tag-export-gck-as-genbank tag-genbank-features tag-gene-construction-kit-tutorials tag-share-gck-files comments-open pings-closed y2012 m09 d30 h04 alt slug-tutorial-export-as-genbank

Tutorial: Export as GenBank

1. Start GCK. 2. Open the GCK file titled G_gamma globin found in the Tutorial Files folder by choosing File > Open… . this file has several identified features that we might like to share with a colleague. 3. To preserve the features in a text format we can choose File > Export.. . and […]
Posted in gene construction kit tutorials | Tagged , , , | Leave a comment
1247hentry p5 post publish author-textco-biosoftware-inc category-gene-construction-kit-tutorial tag-find-positions tag-go-to-position-in-sequence comments-open pings-closed y2012 m09 d30 h04 slug-tutorial-go-to-position

Tutorial: Go to Position

1. Start GCK. 2. Open the file called pBR322 in the Tutorial Files folder by choosing File > Open… 3. Switch to sequence display by choosing Construct > Display > Display Sequence 4. Choose Construct > Go to Position… . This will bring up Figure 2.89. 5. Enter the range of nucleotides as shown: “86-1276” […]
Posted in gene construction kit tutorials | Tagged , | Leave a comment