Tag Archives: Find Mismatches in Sequence

June Newsletter – Tips & Time Savings with GCK 4.0

West Lebanon, NH 06|12|2013 To review this latest Newsletter in your browser,┬áplease click here. In this latest edition of the Textco BioSoftware newsletter, we introduce the updated “Find Sequence” search engine, and review how users can search for a string of nucleotides that might have point mutations, or a range of ambiguity from the original […]
Posted in news | Also tagged , , , , , , , | Leave a comment

Tutorial: Find Sequence

1. Start GCK. 2. Open the file called pBR322 in the Tutorial Files folder by choosing File > Open… . 3. Choose Edit > Find > Find.. . to bring up Figure 2.91. 4. Enter the first few characters (or Copy and Paste) from the following nucleotide string into the Find window: ACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGA GCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCG Note: […]
Posted in gene construction kit tutorials | Also tagged , , | Leave a comment