Tag Archives: Find Sequence

May Newsletter – Tips & Time Savings with GI & GCK

Review "Analysis Suites" in GI - and the enhanced "Find Sequence" capabilities of GCK!
Posted in news | Also tagged , , , , , | Leave a comment

Tutorial: Find Sequence

1. Start GCK. 2. Open the file called pBR322 in the Tutorial Files folder by choosing File > Open… . 3. Choose Edit > Find > Find.. . to bring up Figure 2.91. 4. Enter the first few characters (or Copy and Paste) from the following nucleotide string into the Find window: ACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGA GCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCG Note: […]
Posted in gene construction kit tutorials | Also tagged , , | Leave a comment