Tag Archives: Gene Construction Kit Tutorials

Tutorial: Auto Annotation

Building on the foundation of AutoFeature file (Tutorial 21) introduced in GCK 4.0, AutoAnnotation is a new extension that when turned on, provides a link between a GCK construct file and an AutoFeature file. Choosing the menu option Construct > Features > AutoAnnotation… brings up the same dialog allowing a user to choose an AutoFeature […]
Posted in gene construction kit tutorials | Also tagged , | Leave a comment

February Newsletter-Tips & Time Savings with GI & GCK

Learn about "Hotlinking" analyses to sequences in Gene Inspector - and how to setup AutoFeature files in Gene Construction Kit to help identify primers that contain variations from project to project.
Posted in news | Also tagged , , , , , , , , , | Leave a comment

September Newsletter- Tips & Time Savings with GCK & GI

Textco's latest newsletter highlights how to benefit from the File Searching routine in GCK, and how custom Analysis Suites in GI can save you hours when investigating new sequences - read more...
Posted in news | Also tagged , , , , , , | Leave a comment

June Newsletter – Tips & Time Savings with GCK 4.0

West Lebanon, NH 06|12|2013 To review this latest Newsletter in your browser,¬†please click here. In this latest edition of the Textco BioSoftware newsletter, we introduce the updated “Find Sequence” search engine, and review how users can search for a string of nucleotides that might have point mutations, or a range of ambiguity from the original […]
Posted in news | Also tagged , , , , , , , | Leave a comment

January Newsletter – GCK 4.0 Tips & Tricks

Designed to offer helpful tips to our user community, the January 2013 edition of the Textco BioSoftware Newsletter has been published.
Posted in news | Also tagged , , , | Leave a comment

Tutorial: Mark AutoFeatures

1.¬† Start GCK. 2. Open the file titled Common Features.gcf in the Tutorial Files folder by choosing File > Open… to bring up Figure 2.92. This is a new AutoFeature window. For now, just explore the various options in this window but leave the entries and formatting intact. Entries defined in the left-hand panel can […]
Posted in gene construction kit tutorials | Also tagged , , , , , , | 1 Comment

Tutorial: Copy & Paste Styles

1. Start GCK. 2. Open the file called construct#7 in the Tutorial Files folder by choosing File > Open… . 3. It should be displayed in graphic view, but if not select Construct > Display > Display Graphics . 4. Select the segment of DNA (red circle) that represents the ampicillin resistance gene by double-clicking […]
Posted in gene construction kit tutorials | Also tagged , , | Leave a comment

Tutorial: Find Sequence

1. Start GCK. 2. Open the file called pBR322 in the Tutorial Files folder by choosing File > Open… . 3. Choose Edit > Find > Find.. . to bring up Figure 2.91. 4. Enter the first few characters (or Copy and Paste) from the following nucleotide string into the Find window: ACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGA GCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCG Note: […]
Posted in gene construction kit tutorials | Also tagged , , | Leave a comment

Tutorial: Export as GenBank

1. Start GCK. 2. Open the GCK file titled G_gamma globin found in the Tutorial Files folder by choosing File > Open… . this file has several identified features that we might like to share with a colleague. 3. To preserve the features in a text format we can choose File > Export.. . and […]
Posted in gene construction kit tutorials | Also tagged , , | Leave a comment

Tutorial: Database Searching

GCK has the ability to let you search criteria once and then search multiple databases on the web for matches. It eliminates the need for you to reformat your query for each web site.
Posted in gene construction kit tutorials | Also tagged , , , , , , , , , | Leave a comment