archives

Author Archives: Textco BioSoftware, Inc.

January Newsletter – GCK 4.0 Tips & Tricks

By Textco BioSoftware, Inc. | Published: January 16, 2013
Designed to offer helpful tips to our user community, the January 2013 edition of the Textco BioSoftware Newsletter has been published.
Posted in news | Tagged , , , , | Leave a comment

Gene Construction Kit & Gene Inspector Compatible with Windows 8

By Textco BioSoftware, Inc. | Published: October 24, 2012
Windows 8 Compatible - GCK & GI
Posted in news | Tagged , , , , , , , , , , | Leave a comment

Gene Construction Kit® 4.0 Upgrade Now Shipping

By Textco BioSoftware, Inc. | Published: October 16, 2012
Offers New Automated Routines to Save Time
Posted in news | Tagged , , , , , , , , , | Leave a comment

Tutorial: Mark AutoFeatures

By Textco BioSoftware, Inc. | Published: September 30, 2012
1.  Start GCK. 2. Open the file titled Common Features.gcf in the Tutorial Files folder by choosing File > Open… to bring up Figure 2.92. This is a new AutoFeature window. For now, just explore the various options in this window but leave the entries and formatting intact. Entries defined in the left-hand panel can […]
Posted in gene construction kit tutorials | Tagged , , , , , , , | 1 Comment

Tutorial: Copy & Paste Styles

By Textco BioSoftware, Inc. | Published: September 30, 2012
1. Start GCK. 2. Open the file called construct#7 in the Tutorial Files folder by choosing File > Open… . 3. It should be displayed in graphic view, but if not select Construct > Display > Display Graphics . 4. Select the segment of DNA (red circle) that represents the ampicillin resistance gene by double-clicking […]
Posted in gene construction kit tutorials | Tagged , , , | Leave a comment

Tutorial: Find Sequence

By Textco BioSoftware, Inc. | Published: September 30, 2012
1. Start GCK. 2. Open the file called pBR322 in the Tutorial Files folder by choosing File > Open… . 3. Choose Edit > Find > Find.. . to bring up Figure 2.91. 4. Enter the first few characters (or Copy and Paste) from the following nucleotide string into the Find window: ACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGA GCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCG Note: […]
Posted in gene construction kit tutorials | Tagged , , , | Leave a comment

Tutorial: Export as GenBank

By Textco BioSoftware, Inc. | Published: September 30, 2012
1. Start GCK. 2. Open the GCK file titled G_gamma globin found in the Tutorial Files folder by choosing File > Open… . this file has several identified features that we might like to share with a colleague. 3. To preserve the features in a text format we can choose File > Export.. . and […]
Posted in gene construction kit tutorials | Tagged , , , | Leave a comment

Tutorial: Go to Position

By Textco BioSoftware, Inc. | Published: September 30, 2012
1. Start GCK. 2. Open the file called pBR322 in the Tutorial Files folder by choosing File > Open… 3. Switch to sequence display by choosing Construct > Display > Display Sequence 4. Choose Construct > Go to Position… . This will bring up Figure 2.89. 5. Enter the range of nucleotides as shown: “86-1276” […]
Posted in gene construction kit tutorials | Tagged , | Leave a comment

Gene Construction Kit® 4.0 Beta Announced…

By Textco BioSoftware, Inc. | Published: August 21, 2012
GCK 4.0 Open Beta Testing Begins Today
Posted in news | 3 Comments

Gene Inspector® version 2.0 Now Shipping

By Textco BioSoftware, Inc. | Published: May 1, 2012
The new Gene Inspector version 2.0 features updated analysis routines for faster processing, offers support for the latest operating systems for both Mac and Windows, and researchers will notice smoother font and analysis displays producing crisper notebook entries.
Posted in news | Tagged , , , , , , , , | Leave a comment