Categories
Archives
- December 2020
- September 2020
- February 2018
- November 2017
- May 2014
- February 2014
- September 2013
- June 2013
- May 2013
- January 2013
- October 2012
- September 2012
- August 2012
- May 2012
- February 2012
- September 2011
- August 2011
- July 2011
- May 2011
- February 2011
- November 2010
- September 2010
- June 2010
- May 2010
- March 2010
- January 2010
- December 2009
- October 2009
- July 2009
- April 2009
- March 2009
- February 2009
- January 2009
- September 2008
- April 2008
- February 2008
- April 2007
- March 2007
- November 2006
- April 2006
- March 2006
- January 2006
Tag Archives: DNA search
June Newsletter – Tips & Time Savings with GCK 4.0
West Lebanon, NH 06|12|2013 To review this latest Newsletter in your browser, please click here. In this latest edition of the Textco BioSoftware newsletter, we introduce the updated “Find Sequence” search engine, and review how users can search for a string of nucleotides that might have point mutations, or a range of ambiguity from the original […]
Tutorial: Find Sequence
1. Start GCK. 2. Open the file called pBR322 in the Tutorial Files folder by choosing File > Open… . 3. Choose Edit > Find > Find.. . to bring up Figure 2.91. 4. Enter the first few characters (or Copy and Paste) from the following nucleotide string into the Find window: ACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGA GCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCG Note: […]
September Newsletter- Tips & Time Savings with GCK & GI