Categories
Archives
- December 2020
- September 2020
- February 2018
- November 2017
- May 2014
- February 2014
- September 2013
- June 2013
- May 2013
- January 2013
- October 2012
- September 2012
- August 2012
- May 2012
- February 2012
- September 2011
- August 2011
- July 2011
- May 2011
- February 2011
- November 2010
- September 2010
- June 2010
- May 2010
- March 2010
- January 2010
- December 2009
- October 2009
- July 2009
- April 2009
- March 2009
- February 2009
- January 2009
- September 2008
- April 2008
- February 2008
- April 2007
- March 2007
- November 2006
- April 2006
- March 2006
- January 2006
Tag Archives: Find Mismatches in Sequence
Tutorial: Find Sequence
1. Start GCK. 2. Open the file called pBR322 in the Tutorial Files folder by choosing File > Open… . 3. Choose Edit > Find > Find.. . to bring up Figure 2.91. 4. Enter the first few characters (or Copy and Paste) from the following nucleotide string into the Find window: ACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGA GCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCG Note: […]
Posted in gene construction kit tutorials Also tagged DNA search, Find Sequence, Gene Construction Kit Tutorials Leave a comment
June Newsletter – Tips & Time Savings with GCK 4.0