Categories
Archives
- December 2020
- September 2020
- February 2018
- November 2017
- May 2014
- February 2014
- September 2013
- June 2013
- May 2013
- January 2013
- October 2012
- September 2012
- August 2012
- May 2012
- February 2012
- September 2011
- August 2011
- July 2011
- May 2011
- February 2011
- November 2010
- September 2010
- June 2010
- May 2010
- March 2010
- January 2010
- December 2009
- October 2009
- July 2009
- April 2009
- March 2009
- February 2009
- January 2009
- September 2008
- April 2008
- February 2008
- April 2007
- March 2007
- November 2006
- April 2006
- March 2006
- January 2006
Tag Archives: Gene Construction Kit Tutorials
February Newsletter-Tips & Time Savings with GI & GCK
Learn about "Hotlinking" analyses to sequences in Gene Inspector - and how to setup AutoFeature files in Gene Construction Kit to help identify primers that contain variations from project to project.
September Newsletter- Tips & Time Savings with GCK & GI
Textco's latest newsletter highlights how to benefit from the File Searching routine in GCK, and how custom Analysis Suites in GI can save you hours when investigating new sequences - read more...
June Newsletter – Tips & Time Savings with GCK 4.0
West Lebanon, NH 06|12|2013 To review this latest Newsletter in your browser, please click here. In this latest edition of the Textco BioSoftware newsletter, we introduce the updated “Find Sequence” search engine, and review how users can search for a string of nucleotides that might have point mutations, or a range of ambiguity from the original […]
January Newsletter – GCK 4.0 Tips & Tricks
Designed to offer helpful tips to our user community, the January 2013 edition of the Textco BioSoftware Newsletter has been published.
Posted in news Also tagged AutoFeature, Copy & Paste Styles, GCK Tips, Gene Construction Kit Tips Leave a comment
Tutorial: Mark AutoFeatures
1. Start GCK. 2. Open the file titled Common Features.gcf in the Tutorial Files folder by choosing File > Open… to bring up Figure 2.92. This is a new AutoFeature window. For now, just explore the various options in this window but leave the entries and formatting intact. Entries defined in the left-hand panel can […]
Posted in gene construction kit tutorials Also tagged Automark GCK features, enhancers, features, genes, oligos, primers, promoter 1 Comment
Tutorial: Copy & Paste Styles
1. Start GCK. 2. Open the file called construct#7 in the Tutorial Files folder by choosing File > Open… . 3. It should be displayed in graphic view, but if not select Construct > Display > Display Graphics . 4. Select the segment of DNA (red circle) that represents the ampicillin resistance gene by double-clicking […]
Posted in gene construction kit tutorials Also tagged Apply Graphic Formatting, Copy Style, Paste Style Leave a comment
Tutorial: Find Sequence
1. Start GCK. 2. Open the file called pBR322 in the Tutorial Files folder by choosing File > Open… . 3. Choose Edit > Find > Find.. . to bring up Figure 2.91. 4. Enter the first few characters (or Copy and Paste) from the following nucleotide string into the Find window: ACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGA GCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCG Note: […]
Posted in gene construction kit tutorials Also tagged DNA search, Find Mismatches in Sequence, Find Sequence Leave a comment
Tutorial: Database Searching
GCK has the ability to let you search criteria once and then search multiple databases on the web for matches. It eliminates the need for you to reformat your query for each web site.
Posted in gene construction kit tutorials Also tagged Biological Database Search, Gene Construction Kit, GO, KEGG, OMIM, PDB, PubMed, SCOP, SwisProt, Tutorials Leave a comment
Tutorial: Auto Annotation